Thursday, August 27, 2020
Kinesthetic learning Essay
Sensation learning is otherwise called material learning. Individuals with an inclination for sensation learning are additionally regularly known as ââ¬Å"do-ersâ⬠. Material/sensation students make up around five percent of the populace. Sound-related students Perusing or composing inclination students Sensation students Substance 1 History 2 Characteristics 3 Classification 4 Lack of proof 5 References 6 External connections History Sensation knowledge was initially combined with material capacities, and was characterized and examined in Howard Gardnerââ¬â¢s Frames Of Mind: The Theory of Multiple Intelligences. In his book, Gardner portrays exercises, (for example, moving and performing medical procedure) as requiring extraordinary sensation insight: utilizing the body to make (or accomplish) something. Margaret Hââ¬â¢Doubler composed and talked about sensation getting the hang of during the 1940s, characterizing sensation learning as the human bodyââ¬â¢s capacity to communicate through development and move. Attributes Question book-new.svg This segment doesn't refer to any references or sources. If you don't mind help improve this segment by adding references to dependable sources. Unsourced material might be tested and evacuated. (October 2010) According to the hypothesis of learning styles, understudies who have a dominatingly sensation style are believed to be disclosure students: they have acknowledgment through doing, as opposed to suspecting before starting activity. They may battle to learn by perusing or tuning in. When learning, it causes for these understudies to move around; this expands the studentsââ¬â¢ understanding, with students for the most part showing signs of improvement checks in tests when they can do as such. Sensation students for the most part prevail in exercises, for example, science tests, brandishing exercises, craftsmanship and acting; It is regular for sensation students to concentrate on two distinct things simultaneously, recollecting things corresponding to what they were doing. They have great eyeââ¬hand coordination. In sensation getting the hang of, learning happens by the student utilizing their body to communicate an idea, a thought or an idea (in any field). In a basic study hall setting, these understudies may stand apart in view of their need to move; their high vitality levels may make them be unsettled, anxious or fretful. Sensation learnersââ¬â¢ short-and long haul recollections are fortified by their utilization of development. Characterization Rita Dunn fights that sensation and material learning are the equivalent style.[3] Galeet BenZion attests that sensation and material learning are isolated learning styles, with various qualities. She characterized sensation learning as the procedure that outcomes in new information (or comprehension) with the association of the learnerââ¬â¢s body development. This development is performed to build up new (or expanding existing) information. Sensation learning at its best, BenZion found, is built up when the student utilizes language (their own words) so as to characterize, clarify, resolve and sort out how their bodyââ¬â¢s development mirrors the idea investigated. One model is an understudy utilizing development to discover the entirety of 1/2 in addition to 3/4 through development, at that point clarifying how their movements in space reflect theâ mathematical process prompting the right answer. Absence of proof In spite of the fact that the idea of learning styles is famous among teachers in certain nations (and youngsters and grown-ups express inclinations for specific methods of learning), there is no proof that distinguishing a studentââ¬â¢s learning style delivers better results; in actuality, there is significant proof that the lattice speculation (that an understudy will learn best whenever instructed in a technique esteemed proper for the studentââ¬â¢s learning style) is invalid. All around structured examinations ââ¬Å"flatly negate the well known cross section hypothesisâ⬠. Advocates express that the proof identified with sensation students profiting by specific guidance (or focused on materials) seems blended, best case scenario; the analysis of sensation and material learning is coupled (instead of secluded), and instructors are probably going to misdiagnose studentsââ¬â¢ learning styles. Then again, examines do show that blended methodology introductions (for example, utilizing sound-related and visual strategies) improve brings about an assortment of subjects. Guidance that animates more than sound-related learning (for instance, sensation learning) is bound to upgrade learning in a heterogeneous understudy populace.
Saturday, August 22, 2020
The Google Maps Road Rally Essay Example | Topics and Well Written Essays - 250 words
The Google Maps Road Rally - Essay Example Austin spreads into 271.8 squares miles in which 6.9 square miles possesses the water. Austin is situated close to Colorado River alongside three wonderful counterfeit lakes prefixing with lake named as Bird Lake, Austin, and Walter E. Long. Google maps give the area of lake Austin as appeared in the underneath figure from the site of Google maps in the wake of zooming the area. There is wonderful wildflower knoll and bush/sapling environment is developing as the trees develop in stretch of riverbank other than Colorado River. Different species is likewise indicating nearness. Organic decent variety, better water quality, improvement in oxygen level and flood control is likewise useful keeping up feasible environment in region. The store made in 1939 backings the power age and flood control estimation in the zone. Mount Bonnell is somewhere else of enthusiasm for the region of Lake Austin to fill in as watchtower for the city inhabitants. This serves to give touring to the guests fro m the tallness of 780-feet with moniker Covert Park in the zone of 5.36 sections of land to appreciate the natureââ¬â¢s magnificence present in encompassing slopes (ââ¬Å"Google Mapsâ⬠). Populace of city is commanded by 63.7% of White Americans in which 49.9% are non-Hispanic as indicated by the overview of 2005-07. The Hispanic populace adds to the 30.5% of the populace. Climate state of city underpins the commonness of subtropical muggy atmosphere that can give radiant days across more often than not in the year. Snowfalls are uncommon however, it happens at the interim of two years. City organization involves the individual from board to keep up the administration and law in the Austin. Politically the city stays separated into the gatherings of hippie and advertisers of urban progression (ââ¬Å"Google Mapsâ⬠). Financially Austin stays one of the flourishing city of the US going about as center for innovative organizations including IT goliaths, for example, Dell, IBM, Motorola, HP, Apple. College of Texas stays one
Friday, August 21, 2020
Twitter Outlines New Policies to Reduce Financial Scams - OppLoans
Twitter Outlines New Policies to Reduce Financial Scams - OppLoans Twitter Outlines New Policies to Reduce Financial Scams Twitter Outlines New Policies to Reduce Financial ScamsInside Subprime: October 18, 2019By Lindsay FrankelLast month, Twitter announced that it was banning financial scams on its platform. Until now, Twitterâs documentation did not directly address financial scams, which were dealt with through spam reporting. Last year, Twitter expanded spam reporting to help users identify what type of spam they were reporting.The expanded spam reporting did not include an option to identify financial scams. Now, the new policy spells out what Twitter considers a financial scam: âUsing scam tactics on Twitter to obtain money or private financial information is prohibited under this policy. You are not allowed to create accounts, post Tweets, or send Direct Messages that solicit engagement in such fraudulent schemes.âAccording to the policy, this includes, relationship/trust-building scams (including impersonating a public figure or organization), money-flipping schemes (asking for a small amo unt of money in return for a large amount), fraudulent discounts, and phishing schemes.Twitter has been criticized in the past for how it has handled financial scams. Early in the year, The Next Web reported that Twitter had allowed a phishing scam to run as a promoted tweet. Scams related to cryptocurrency have also run on the platform without detection.Users still report scam the same way they report any spam: by clicking Report Tweet and then selecting Itâs Suspicious or Spam. There is then an option to elaborate.Twitter has been trying to crack down on abuse on its platform in 2019, with founder Jack Dorsey saying, âWe are taking a more proactive approach to reducing abuse and its effects on Twitter at a TED conference in April. Early this year, it reported a 16 percent drop in reported abuse (as well as a healthy surge in revenue). If financial scammers continue to post suspicious tweets, they risk their accounts being locked or blocked from the platform.Learn more about p ayday loans, scams, and cash advances by checking out our city and state financial guides, including Chicago, Illinois, Florida, Texas, and more.Visit OppLoans on YouTube | Facebook | Twitter | LinkedIn
Monday, May 25, 2020
Essay on Indecision, Hesitation and Delay in...
Admonished by the ghost of his poisoned father, troubled by the stench of a kingdom in decline, outraged by his queen mothers incestuous liaison, why did Hamlet wait so long to act decisively? Theories abound. Hamlet had an Oedipus complex. Hamlet was mad rather than merely pretending to be. Hamlet was an intellectual pansy. Hamlet was an existentialist. Etc. T. S. Eliot went so far as to say that the play itself was flawed, Hamlets Problem actually the authors own, insoluble. I believe that the Problem is actually ours. Perhaps the real issue is not Hamlets hesitation, but our unwillingness to understand it. In an ironic maneuver, Shakespeare has Hamlet tell us about the self-destructive power of a tragic flaw: So,â⬠¦show more contentâ⬠¦He obviously refers to himself. The terrible shock of his fathers murder has gotten him thinking, probably for the first time in his young and (according to Ophelias description) idealistic life, about the irreversible reality of death. If nothing lasts and the good guys are mortal and the noblest minds and their brightest dreams can succumb to a dose of poison, what difference can anything make? What basis can there be for action? The composer of Prufrock and The Hollow Men should really have known better. Far from making it a mystery, Shakespeare uses scene after scene to drive home the link between Hamlets passivity and his preoccupation with death and decay, although Hamlet himself does not--and for purposes of tragedy cannot--grasp this connection until its too late. That Shakespeare thus enlightens us (or tries to) through his bewildered and introspective sufferer constitutes a supreme dramatic achievement. For instance: How stand I then, That have a father killd, a mother staind, Excitements of my reason and my blood, And let all sleep? while, to my shame, I see The imminent death of twenty thousand men, That, for aShow MoreRelated Indecision, Hesitation and Delay in Shakespeares Hamlet - Procrastination and Indecision1770 Words à |à 8 PagesHamlet ââ¬â the Hesitation and Indecisionà à à à à à Is there a plausible explanation for the hesitation by Hamlet in carrying out the ghostââ¬â¢s request in Shakespeareââ¬â¢s Hamlet? à Lawrence Danson in the essay ââ¬Å"Tragic Alphabetâ⬠discusses the hesitation in action by the hero; this is related to his hesitation in speech: à To speak or act in a world where all speech and action are equivocal seeming is, for Hamlet, both perilous and demeaning, a kind of whoring. The whole vexed questionRead More Indecision, Hesitation and Delay in Shakespeares Hamlet Essay1334 Words à |à 6 PagesHesitation in Hamlet à à à à William Shakespeares Hamlet is tragic because all of the enmity being the product of one mans inability to make decisions. I believe the play is showing the steps of hesitation a person goes through who cannot choose, and the resultant angst. This one man is Prince Hamlet. Throughout the play he comes into situations where he just cant move himself into action. In Act I, Scene 5 Hamlet has an encounter with a ghost who explains that it is Hamlets deceasedRead MoreIndecision, Hesitation and Delay in Shakespeares Hamlet Essay1829 Words à |à 8 Pagesand highly controversial plays, the tragedy known as Hamlet, Prince of Denmark. Shakespeare in his play introduces us the pays one of his most popular, enigmatic, and dynamic characters the tragic hero Prince Hamlet. Hamlet is presented to us a sensitive, religious, loyal, moral, intellectual, and young university student who often contemplates difficult philosophical questions that cannot be answered with any degree of certainty. When Hamlet learns that his father, the king of Denmark, had beenRead MoreEssay on The Character of Hamlet in William Shakespeares Play1618 Words à |à 7 PagesThe Character of Hamlet in William Shakespeares Play Some critics have stated that the appeal of Hamlet to the audience is his many human weaknesses, the most notable being his indecision. His deliberations and procrastinations are particularly high-lighted when he is faced with the task of revenge. The law and Christianity, around the early seventeenth century, were clear in condemning personal revenge as an attempt by man to arrogate the prerogatives of God. Hamletââ¬â¢sRead MoreEssay about Indecisiveness in Hamlet839 Words à |à 4 PagesShakespeares Hamlet is truly a great play to analyze. It is also unique in that a play based on revenge we dont see any action until the end. Hamlet has immediate suspicion and proof of his fathers murder and does not act. This poses the question, why does it take so long for Hamlet to kill Claudius? Hamlets apparent indecisiveness to act is due to his constant habit of over thinking in addition to several conscious and subconscious distractions. Immediately following Hamlets conversationRead MoreWilliam Shakespeare s Hamlet As A Tragic Hero1251 Words à |à 6 PagesHamlet is one of Shakespeareââ¬â¢s most famous tragedies. Hamlet himself is commonly known as a tragic hero in the play. He knows he possesses the flaw of indecision but cannot overcome it, and this is a weakness that eventually causes his downfall. Therefore, this paper will discuss his own fate by examining some of his characteristics. Different people have their own understanding towards Hamlet. As a tragic hero, some think he is young, brave and thoughtful; some think he is conscientious, becauseRead MoreEssay : The Tragedy Of Hamlet1515 Words à |à 7 Pagessight of the now. Dont we just muffle ourselves by allowing overthinking to take control? William Shakespeares The Tragedy of Hamlet forces its protagonist to deal with the crossroads. Prince Hamlet has just returned to Denmark to attend his fathers funeral after being away in Germany for school. As time goes on, Hamlet begins to suspect that foul play is the cause of his fathers death. Hamlet proves to be an excellent example of a hero in a tragedy as he allows his paralyzing fear of the unknownRead MoreThe Tragic Flaw Of Shakespeare s Hamlet1734 Words à |à 7 PagesJacqueline Borutski ENG4U Mr. Froome April 11, 2016 The Tragic Overuse of Logic in Hamlet Logic is man s most valuable asset; it is what pushed humanity past other species and helped develop humankind into what it is today. Without such logic and reasoning, humanity would not have evolved into the strongest and most powerful beings alive. It is what has enabled us to dominate the world, create civilization, unlock the secrets of the universe through math and science and reveal the true natureRead MoreHamlet And Laertes By William Shakespeare1469 Words à |à 6 PagesShakespeareââ¬â¢s characters Hamlet and Laertes, in the play Hamlet, attempt to attain revenge for their fathers, but contrast in their approaches to achieving revenge, and their view of life as a whole, their failures revealing the inevitability of fate. Just as Hamletââ¬â¢s inaction hinders him from achieving his goal of killing Claudius, Laertesââ¬â¢s impetuosity similarly leads him astray from his goal their inability to achieve these goals. The power of fate is thereby revealed through the futil ity of humanRead MoreComparing the Characters of Faustus and Hamlet1767 Words à |à 8 PagesBoth Hamlet and Faustus contain a clash of themes and traditions, all catalysed by Religion. This is used to establish a theme of deception, which greatly impacts the protagonistââ¬â¢s procrastination. Procrastination is considered to be Hamletââ¬â¢s tragic flaw, however Faustusââ¬â¢s flaw is considered to be his hubris. Hamlet is in fact a play adapted by Shakespeare, not by name. But there are several scriptures that can be identified to being similar to the plot. One is called Saga of Hrolf Kraki. Believed
Thursday, May 14, 2020
Ptsd A Serious Psychological And Emotional Disease Essay
PTSD is a serious psychological and emotional disease that some people face every day, even here close to home, in fact seven million, seven hundred thousand American adults are diagnosed with this disorder (Feature: Post Traumatic Stress Disorder PTSD: A Growing Epidemic...). PTSD is notable in jobs that put someone ââ¬Å"at risk for being part of a traumatic event, such as police officers, nurses, and firefightersâ⬠(PTSD: Statistics, Causes, Signs, Symptoms). For example, Lt. Samuel S. Stewart said, ââ¬Å"I began to see exactly how PTSD affected my fellow soldiers, their families, and their friendsâ⬠. He then became a police officer and witnessed other officers dealing with the same thing. He found that there was a study ââ¬Å"conducted of thirty-seven police officers that were a part of serious shootingâ⬠events. Out of those thirty-seven, only three showed no signs of PTSD (Stewart). Those who are affected by PTSD donââ¬â¢t always show it, due to the fact t hat PTSD is a mental and emotional disease. Indeed, there are psychological and emotional factors that make peopleââ¬â¢s lives harder. Treatment is needed for those who suffer with PTSD. PTSD stems from a traumatic, life-changing event and can leave psychological scars on someone. Once the event occurs, it triggers the brainââ¬â¢s adrenaline levels and increases them, causing flashbacks that trigger a ââ¬Å"fight or flight reactionâ⬠(NHS). This psychological reaction is the mind telling the person to act out against the danger facing them, or leaveShow MoreRelatedMany Countries/Regions Around The World Strive To Have1033 Words à |à 5 Pagesconflict. Three main costs of fighting for peace include the financial expenses (military), however on a more personal level, there is significant emotional/wellbeing damage caused by war. Finally, conflict creates major environmental problems as a result of military weapons used. The cost of violence is commonly considered/measured in terms of human and emotional cost however the financial cost of global violence is a major additional factor to contemplate. According to the Global Peace Index report,Read MorePost Traumatic Stress Disorder ( Ptsd )1560 Words à |à 7 Pageson long term health of a personââ¬â¢s psychological. War is defined as conflict between two different groups of individuals. There are many reasons for why wars and other conflicts happen, but the warfighter has the greatest psychological burden placed on them. Over time understanding and acceptance on dealing with Post Traumatic Stress Disorder (PTSD) has increase dramatically. Although PTSD can be associated with any event that a person develops a strong emotional response to a remembered event. ConflictRead MoreEffects Of Cancer On Children Under The Age Of 15 ( Toro )869 Words à |à 4 PagesSection One: Saige Weeks Cancer is the leading disease that causes death in children under the age of 15 (Toro, 2001). Every year, approximately 9,000 children are diagnosed with cancer. Almost 1,500 children die because of the disease (Toro, 2001). Despite the the death rate of 1,500 children per year, the number of children surviving cancer is increasing; the current survival rate is over 70 percent (Toro, 2001). Although the rates of survivors have increased due to the invasive and radical treatmentRead MoreThree Main Psychological Disorders1137 Words à |à 5 PagesThree Main Psychological Disorders Introduction Psychological disorders are also referred to as mental disorders. This can be defined as psychological symptoms or behavioral patterns that affect multiple life areas of an individual. In addition, they are likely to cause distress for patients who experience the symptoms. Post-Traumatic Stress Disorder Posttraumatic stress disorder develops because of traumatizing events that threaten the safety of an individual making him/her feel helpless. OftenRead MoreSupport System For Post Traumatic Stress Disorder1549 Words à |à 7 Pagesreappearance of symptoms. Sometimes, the aftermath of PTSD take the form of depressions, anxiety disorders, or abuse of alcohol or drugs. The use of drugs and alcohol could be an attempt on the part of the person suffering to alleviate his anguish or numb fear of threatening situations (Weiss, Garvert, Cloitre, 2015). PTSD can have important consequences on the functions of daily life and can influence several areas of social and emotional behavior .Developing avoidance issues can negatively affectRead MoreDomestic Violence Is A Serious Social Issue1546 Words à |à 7 PagesDomestic violence is a serious social issue, yet often overlooked by society due to insufficient knowledge and misconceptions. It has prevailed for years, and current interventions have not succeeded in eliminating it. One of the biggest myths is that: ââ¬Å"Domestic violence is not common,â⬠while in reality, the number of domestic violence incidents annually ranges from 960,000 to 3 million (Collins et al 169.) According to Maryland Network Against Domestic Violence, it is believed to be the most commonRead MorePost Traumatic Stress Disorder ( Ptsd )1473 Words à |à 6 Pagesresponsibilities of military members encompass large amounts of anxiety, selfless service, and occasionally, terrifying events that cause a nega tive influence on a personââ¬â¢s life. Post-traumatic Stress Disorder (PTSD) is a serious and tragic illness among members serving in our military. Mayo Clinic (2014a) defines PTSD as a mental health condition that s triggered by a terrifying event ââ¬â either experiencing it or witnessing it (p.361). In certain circumstances, this is a daily experience for many members ofRead MorePsychological Disorders : A Psychological Disorder1632 Words à |à 7 PagesPsychological disorders are often a taboo subject in our society. Many find themselves to be the subject of ridicule and/or a social pariah from their peers at the simple hint of a mental disorder. This stems largely from simple ignorance to the cause and actual effects of the problems. Many of the same people that spend most of the day complaining about others that have psychological disorders could potentially find themselves and their behavior defined as such. Psychological disorder are an, ââ¬Å"ongoingRead MoreThe Et hics Of The Counseling Profession1371 Words à |à 6 Pagesresult in direct personal experience of an even that involves actual or threatened death or serious injury or witnessing of an actual or threatened death or serious injury. Traumatic experiences are typical examples of natural disasters, sexual abuse, physical assault, and car accidents, which are linked to post traumatic stress disorder. Shafran, Shafur, Berant, and Gilboa-Schechtman (2016) defined PTSD as a persistent re-experiencing of the traumatic event, avoidance of stimuli associated withRead MoreNegative Effects Of Rape1166 Words à |à 5 Pagesexperience both short and long-term psychological effects of rape. One of the short term effects of rape is Post Traumatic Stress Disorder (PTSD). Common symptoms of PTSD are having flashbacks or nightmares (ââ¬Å"Joyfulâ⬠). Victims tend to have these flashbacks and nightmares due to paranoia. Victims are usually still in shock after the incident and are scared. So me victims also tend to feel guilty, but this cam also be a long term effect. Short term psychological effects of rape can also be long term
Wednesday, May 6, 2020
The Outbreak Of The American Revolution - 952 Words
There are quite a few historical factors that contributed to the outbreak of the American Revolution. The American Revolution began in the mid 1700ââ¬â¢s and ended in the late 1700ââ¬â¢s and took place in the thirteen American colonies. It was all caused by many different wars and conflicts between the British and the American Colonists. There were many contributions to the outbreak such as, the Boston Massacre, Boston Tea Party, the French and Indian War, the Battle of Bunker Hill and many other conflictions. All of these fights and protests greatly contributed to the outbreak of the American Revolution in their own way. First, the French and Indian War took place in 1754 and continued through 1763. The French and Indian War is also known as The Seven years War and ended with The Treaty of Paris in 1763. This war was the first world war that had ever taken place. It took place mostly in Europe, but also took place in America, South America, Asia, India, etc.. One of the major ways that this war contributed to the American Revolution was because of the Stamp Act. The Stamp Act contributed because it caused major conflict between Britain and the colonists. The war was so expensive and because Britain became in debt due to the war they decided to raise revenue by taxing the colonists by stamps which would be called the Stamp Act. This caused many violent protests and even some violent rioting from the colonists. Some colonists even burned down the governorââ¬â¢s house and brutallyShow MoreRelatedThe Second American Revolution: Expressions of Canadian Identity in News Coverage at the Outbreak of the United States Civil War1216 Words à |à 5 Pagesââ¬Å"The Second Revolutionâ⬠: Expressions of Canadian Identity in News Coverage at the Outbreak of the United States Civil War. Gabrialââ¬â¢s article is about how the Canadian identity was challenged by the American Civil War. In particular, he argues that Canadian identity is significant in five impo rtant themes: the importance of British identity, antipathy toward Americanism and suspicion of American democracy, a well-grounded fear of American militarism, a patronizing sympathy for Americans in crisis andRead MoreOut Break of the American Revolution1076 Words à |à 5 PagesOutbreak of the American Revolution 2 The connection between Britain and the English colonies was that of the ruling of the colonies by the king of Britain, King George III and his parliament. The kingââ¬â¢s ruling was very unfavorable for the colonists because of his tyrannic dictatorship and unjustly taxations. The mere thought of an island ruling an entire continent thousands of miles away with poor communication and lack of supervision of the colonies by the king, did not work in favor of theRead MoreThe Revolution Of The American Revolution999 Words à |à 4 PagesBetween 1770 and 1776, resistance to imperial change turned into a full-on revolution. The American Revolution, also known as the Revolutionary War, was a time of revolting and political uprising, in which the 13 colonies separated from the British Empire, forming the independent nation known as the United States of America. Though the American Revolution began because the colonies wanted independence from Britain, many important historical events and revolts also lead to the tensions and resistanceRead MoreRole of Ideas in the French and Russian Revolutions1432 Words à |à 6 PagesWord Count: 1511 How important was the role of ideas in the outbreak of revolution? When comparing the French Revolution of 1789 and Russian October Revolution of 1917, a series of parallels become evident. Both revolutionary groups became determined with an extensive emergence of new ideas, which captured a strong majority of the respective populations. The importance of the ideas was critical to maintaining a drive for the revolutions considering they acted as a manifestation of what the publicRead MoreWhat Caused The French Revolution?917 Words à |à 4 PagesWhat caused the French Revolution? Many things contributed to it evolving. But only three were the most important. The influence dates back all the way to the Age of Enlightenment, the ideas definitely had an effect on the French citizens. The American Revolution ties with the Enlightenment as well. The political inequality of the three estates played a huge part in the disruption. In addition to that, the Economic inequality also influenced France. The French Revolution is a big and memorable partRead More Iran And The Iranian Revolution1227 Words à |à 5 Pagessituation was a contributing factor in the outbreak of the 1979 Iranian Revolution, it was the growing Western influence in Islamic culture that was the main cause for the revolution. The Iranian/Islamic Revolution refers to the events involving the deposing of Mohammad Reza Shah Pahlavi and pro-American government, and the replacement with an anti-Western authoritarian theocracy under the leader of the revolution, the Grand Ayatollah Ruhollah Khomeini. The revolution was mainly supported by various leftistRead MoreThe American Revolutionary War Essay517 Words à |à 3 PagesThe American Revolutionary War (1775ââ¬â1783), the American War of Independence, or simply the Revolutionary War in the United States, was the prosperous military revolt against Great Britain of Thirteen American Colonies which joined together as the United States of America in July 1776. Originally constrained to fighting in those colonies, after 17 78 it additionally became a world war between Britain and France, Netherlands, Spain, and Mysore. The war had its inchoations in the resistance of manyRead MoreEssay on Causes of the American Revolution548 Words à |à 3 PagesThe American Revolution was a dramatic change in the political, social, and economic system of New England. It was not a bloody revolution; on the contrary it is unique because it was not as violence as other revolutions we know (French, Russia and China). The American Revolution had many causes. Long-term social, economic, and political changes in the colonies before 1750 provided the basis for an independent nation with representative political institutions. More immediately, the French andRead MoreIrish Homeland and the Government873 Words à |à 3 Pages but still chafing under this rule and agitating for independence or for governmental and social reform in a variety of areas (Ferriter, n.d.). With a concession for home rule made by the British in 1912 but actual implementation halted with the outbreak of the First World War, Ireland was in a position of uncertainty, with more jobs because of the war but with less optimism for the future in many ways (Ferriter, n.d.). Still not really seen as a land of many opportunities, immigrants from IrelandRead MoreThe American Renaissance Essay1648 Words à |à 7 PagesIn America, the American Renaissance was the period in 1835-1880 in which United States literature came of age as an expre ssion of a national spirit. Literature became one of the most historically significant effects that occurred throughout the time period of the American Renaissance. The American Renaissance is also characterized by renewed national self-confidence new ideas and technologies. Politically and economically, this era coincides with the Gilded Age and the New Imperialism. By the end
Tuesday, May 5, 2020
Real World market Of Reliance Jio Samples â⬠MyAssignmenthelp.com
Questions: 1.Briefly describe the nature and characteristics of the chosen company? 2.Market Structure of the chosen market? 3.Causes for the policy change? 4.One Real life government intervention in the market? 5.Overall benefits or pitfalls of this intervention by the government? Answers: Introduction This essay is about the real world market and a real world company, and about the upcoming or a recently introduced policy of the government. In this essay we will discuss the possible positive or negative effects on the real world market and the company from the policy of the government. In this essay we will choose the telecommunication market of India, and the real world company to be discussed in this essay is Reliance Jio. Within a period of less than a year, reliance jio successfully made a customer base of more than 119 crore(The Free Encylcopedia). The new telecom policy of India is expected to hit this sector in March 2018 and the changes made in it are capable of stirring the growth of the companies falling in this sector. The new telecommunication policy is customer centric and the companies are expected to lessen their revenues to benefits the customers. 1. Reliance Jio is a telecommunication company, the services of jio commercially came into existence on 5th September 2016. The reliance jio is a wholly owned subsidiary of reliance industries. The reliance jio belongs to the telecommunication sector of India. The telecommunication sector of India currently has 12 companies that are providing their broadband and calling services to the Indian market(Shankar, 2013). The characteristics of reliance jio are as under(Features of Jio, 2017): The reliance jio comes with a absolutely desirable characteristic of free calling to its users for a period of 3months or more, if the customer buys a package of Jio. The availability is another major characteristic of Jio. It has tied up with 20 major smart phone companies, which is a very large number by any company in India. Jio provide its users different applications, such as Jio Security to safeguard mobile data, Jio Cinema to entertain customers, Jio Bank to pay electronically etc. The Reliance Jio has not limited itself to the mobile sim but it has also introduced Dongles for a very low price of 1999rs. The Reliance Jio offers very economical plans to the students. The students by providing their student IDs can get 25% more data. 2. The market structure of the telecommunication market is that of oligopoly. Oligopoly is that type of market where there is a small number of sellers selling almost identical goods to a large number of buyers with having some power of influencing the price of the products(Luther, 2015). In this market the action done by one firm can be easily seen in the activities of the other firm. Reliance Jio entered the market with very economical data plans, which were never expected by the other telecommunication companies, these economical plans of Jio, totally destroyed the profits of the other companies. 3. The ministry of communication in India received a lots and lots of complaints from the customers about the high rate charges, drop-calls, roaming etc by the telecom companies. The telecom companies in India, prior to the incorporation of jio were charging exorbitant rates for 4G services, even the calls rate were so high that people were constantly shifting from one network to other. So to make the telecommunication market a customer centric market, the government felt the need to change the policy and by the march of 2018, the new policy will be in the market possibly having following changes(India, 2017): Introduction of 5G services within reasonable prices. Abolition of roaming charges across the country. High penalties over drop calls. If these changes comes into the telecommunication market then there will be an increase in the competition, only key players such as Reliance Jio and Airtel will survive(Mehra, 2017), and this upcoming policy, as said is taking the customer into the centre so ultimately it is going to benefit the pockets of the customer. 4. In India recently GST was introduced. This intervention of the government imposed a fixed 18% tax rate on the telecommunication sector of India. This tax imposition didnt went in the favor of the customers, as the rates of calls, data and other things went so high that customers started shifting to the lower price plans. This intervention by government was only meant to broaden and strengthen the tax structure of India, by only imposing one tax and abolishing all other taxes. 5. Not even the telecommunication industry but the customers are disadvantaged from this intervention, as now the customers are being taxed more. For understanding the disadvantage of this intervention we will here take an example: customers who are having a base plan of rs1000 now needs to pay 1000+ 18% tax, no customer will be happy paying such a higher tax, even the telecom sector itself is not happy with such a high rate of tax as they know, now customers will start shifting from bigger plans to the smaller ones that is ultimately going to affect the profitability of the telecom sector. The experts of the telecommunication sector of India are not in the favor of this tax reform, they said that this hike in tax rates will further increase the burden of this sector as it is already bleeding because of such a high intensity competition between the existing companies, now every companies needs to lower the prices of their existing plans, and in order to do so the companies will left after nothing in their hands(Singh, 2017). Below is a graph that shows how the profits of the telecom industry fell down after the introduction of GST: It is clearly visible that after the implementation of GST the profits of each company is falling and this fall in the profitability is not digested by the telecom sector. Conclusion Above is discussion about the real world market and a real world company that is set up in India. The upcoming policy states that it is customer centric; however the tax on the telecom sector is so exorbitant that this aim of making the policy customer centric doesnt seems to be achievable. Bibliography Features of Jio. (2017). Economic Times , 1. India, M. o. (2017). New Telecom Policy 2018. Delhi: Telecom Ministry of India. Luther, M. (2015). Different structures of market. Bath: London Publishers. Mehra, R. (2017). The entry of Jio and the Upcoming Telecom Policy. India Today , 10. Shankar, R. P. (2013). Telecom Sector In India. Lucknow: U.P Printing Press. Singh, H. (2017). Pitfalls of GST. Mumbai: Kalyani Publishers. The Free Encylcopedia. (n.d.). Retrieved Feburary 15th, 2017, from Wikipedia: https://en.wikipedia.org/wiki/Jio
Thursday, April 9, 2020
Monday, March 9, 2020
Phenylalanine hydroxylase (PAH) Gene Essay Example
Phenylalanine hydroxylase (PAH) Gene Essay Example Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Background: Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1). Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6). Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000 à µmol compared to the normal 100 à µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600 à µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi ld and severe mutations (4, 7, 8). Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as ââ¬Å"mousyâ⬠, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8). Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6). Results and Discussion: PAH chromosomal map position and nearby genes: The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb. Figure 1 Chromosome 12 (9) Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the ââ¬Å"Locationâ⬠link on the PAH listing. The website lists the location of the gene to be at ââ¬Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.â⬠(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes. Figure 2 Detailed view of region near PAH (9) The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading ââ¬Å"Cytoâ⬠(for cytogenic) and stated as ââ¬Å"12q22-q24.2â⬠(10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes are actually near PAH, although zooming in on the ââ¬Å"Genes on Sequenceâ⬠and ââ¬Å"Phenotypeâ⬠maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question. The intron/exon structure of the PAH gene: It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link ââ¬Å"svâ⬠led to a page with the title ââ¬Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.â⬠Searching for the gene gives the following (zoomed-in and cropped) structure: à Figure 3 Structure of PAH gene (11) Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under ââ¬Å"ensRNAâ⬠: à Figure 4 Another illustration of the structure of PAH gene (11) Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1: Figure 5 Ensembl illustration of PAH gene structure This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand. Common PAH mutations: Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6) Table1 PAH mutation statistics Mutation Type: # of Mutation(s) Missense 336 Deletion 73 Splice 62 Silent 32 Nonsense 28 Insertion 10 Sil./Splice 3 Unknown 3 Total mutations: 547 Most reported Mutation (Association): p.R408W (214) Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12) à Other examples can be seen in Appendix (I). As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3) Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations. Single nucleotide polymorphisms (SNPs) of the PAH gene: To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13). Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format: rs79931499 [Homo sapiens] CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT 12 The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them. Designing PCR primers: The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III). References: 1. [26/08/10]; Available from: ncbi.nlm.nih.gov/omim/612349 2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2. 3. [21/09/09]; Available from: ensembl.org/index.html. 4. [26/08/10]; Available from: genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc 5. [26/08/10]; Available from: pahdb.mcgill.ca. 6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70. 7.à [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria 8. [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku 9. [26/08/10]; Available from: ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000 10. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah 11. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686 12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism 13.à à à à à à à [updated 21/09/09]; Available from: ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053 14.à à à à à à à [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi Appendices: Appendix (I) Examples 1. Systematic Name: c.1AG Region: E1 Reference (1st): Mutation Name: p.M1V Sequence: 0.000 JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989 Other Name: ATG/GTG Length: 1 Nucleotide No.: 1 Rest. Site: -Xba I Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 2. Systematic Name: c.3GA Region: E1 EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃâ¦LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992 Mutation Name: p.M1I Sequence: 3.000 Other Name: ATG/ATA Length: 1 Nucleotide No.: 3 Rest. Site: -NspI Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 3. Systematic Name: c.117CG Region: E2 FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991 Mutation Name: p.F39L Sequence: 117.000 Other Name: TTC/TTG Length: 1 Nucleotide No.: 117 Rest. Site: -MboII, +MaeIII Mutation Type: Missense Syst. Name gDNA: Erlandsen H, Pey AL, Gmez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations. Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No Appendix (II) SNPs of the PAH gene Region Contig position mRNA pos dbSNP rs# cluster id Hetero- zygosity Function dbSNP allele Protein residue Codon pos Amino acid pos exon_12 26716405 1750 rs59326968 N.D. synonymous C Asn [N] 3 426 contig reference T Asn [N] 3 426 exon_7 26728783 1314 rs5030851 N.D. missense T Leu [L] 2 281 contig reference C Pro [P] 2 281 exon_6 26731200 1061 rs5030653 N.D. missense (22bp) [CIKPMLAN] 1 197 frame shift -/TGTATAAAACCCATGCTTGCTA 1 197 contig reference (22bp) [LYKTHACY] 1 197 26731262 1020 rs17852373 N.D. missense G Gly [G] 2 183 contig reference A Glu [E] 2 183 exon_3 26770856 671 rs5030842 N.D. missense C Pro [P] 1 67 contig reference T Ser [S] 1 67 contig reference A Ser [S] 3 36 exon_1 26793098 474 start codon 1 Appendix (III) Designed Primers Exon1 ENSE00001141448 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG PCR primer design: No mispriming library specified Using 1-based sequence positions OLIGOà à à à à à à à à à à à à à à à à à à à à à start à à len à à à tm à à à à à à gc% à à anyà à à 3à à à à à à seq LEFT PRIMERà à à à à à à à à 369à à 20à à 59.83à à 55.00à 6.00à 2.00 à à TCCTCCCTAGTGCGAGGTTA RIGHT PRIMERà à à à à à 522à à 20à à 59.98à à 55.00à 3.00à 2.00 à à CAGAGAGTTTCCTGCCCAAG SEQUENCE SIZE: 533 INCLUDED REGION SIZE: 533 PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00 1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT 61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC 121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG 181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG 241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA 301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA 361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC 421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA 481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start à à len à à à tm à à à à à à gc% à à anyà à à à à 3à à à à à à à à à à à seq 1 LEFT PRIMERà à à à à à à à 339à à 20à à 59.77à à 50.00 à à 3.00 à à 1.00à à à à ACGCAAGAGACACCCTTTGT RIGHT PRIMERà à à à à à 522à à 20à à 59.98à à 55.00 à à 3.00 à à 2.00 à à à à à CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00 2 LEFT PRIMERà à à à à à à 318à à 20à à 59.32à à 55.00à 4.00à 2.00 GTTACTGTGCGGAGATGCAC RIGHT PRIMERà à à à à à 522à à 20à à 59.98à à 55.00à 3.00à 2.00 CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 3 LEFT PRIMERà à à à à à à 157à à 20à à 60.07à à 55.00à 2.00à 0.00 CTGGCTTCTTCCCTTTACCC RIGHT PRIMERà à à à à à 337à à 20à à 59.32à à 55.00à 4.00à 3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMERà à à à à à à 156à à 20à à 60.07à à 55.00à 3.00à 0.00 CCTGGCTTCTTCCCTTTACC RIGHT PRIMERà à à à à à 337à à 20à à 59.32à à 55.00à 4.00à 3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 Statistics conà à tooà à à inà à à inà à à à à à à à à noà à à tmà à à tmà highà highà à à à à à à high sidà manyà à tarà exclà à badà à à GCà à tooà à tooà à anyà à à 3à polyà à end eredà à à Nsà à getà à regà à GC% clampà à lowà high compl complà à à à Xà stabà à à ok Leftà à à 3637à à à à 0à à à à 0à à à à 0à à 162à à à à 0à à 419à 2558à à à à 0à à à à 2à à à 22à à à 73à à 401 Rightà à 3701à à à à 0à à à à 0à à à à 0à à 130à à à à 0à à 321à 2817à à à à 0à à à à 2à à à à 0à à à 78à à 353 Pair Stats: considered 140, unacceptable product size 129, high end compl 3, ok 8 primer3 release 1.1.4 KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start à à len à à à tm à à à à à à gc% à à anyà à à 3à à à à à à à à seq 1 LEFT PRIMERà à à à à à à à 19à à 20à à 60.21à à 50.00à 5.00à 2.00 à à à à GCAGTGCCCTCCAGAAAATA RIGHT PRIMERà à à à à à 265à à 20à à 58.12à à 40.00à 3.00à 0.00 à à TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00 2 LEFT PRIMERà à à à à à à à 19à à 20à à 60.21à à 50.00à 5.00à 2.00à à à GCAGTGCCCTCCAGAAAATA RIGHT PRIMERà à à à à à 260à à 22à à 60.05à à 40.91à 4.00à 0.00 à à GATGACCCCAAAAGATTTACCA PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 3 LEFT PRIMERà à à à à à à à 45à à 20à à 60.39à à 50.00à 6.00à 1.00à à à AGCCATGGACAGAATGTGGT RIGHT PRIMERà à à à à à 265à à 20à à 58.12à à 40.00à 3.00à 0.00 à à TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMERà à à à à à à à 19à à 20à à 60.21à à 50.00à 5.00à 2.00 à à à à GCAGTGCCCTCCAGAAAATA RIGHT PRIMERà à à à à à 258à à 20à à 57.92à à 40.00à 4.00à 0.00 à à TGACCCCAAAAGATTTACCA PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 Statistics conà à tooà à à inà à à inà à à à à à à à à noà à à tmà à à tmà highà highà à à à à à à high sidà manyà à tarà exclà à badà à à GCà à tooà à tooà à anyà à à 3à polyà à end eredà à à Nsà à getà à regà à GC% clampà à lowà high compl complà à à à Xà stabà à à ok Leftà à à 7708à à à à 0à à à à 0à à à à 0à à 791à à à à 0à 4562à à 600à à à à 0à à à 14à à à à 0à à à 52à 1689 Rightà à 7734à à à à 0à à à à 0à à à à 0à 1269à à à à 0à 4609à à 311à à à à 0à à à à 6à à à à 0à à à 44à 1495 Pair Stats: considered 2222, unacceptable product size 2195, high end compl 6, ok 21 primer3 release 1.1.4
Saturday, February 22, 2020
Hacking Exposed Essay Example | Topics and Well Written Essays - 500 words
Hacking Exposed - Essay Example Similarly, he could acquire social security numbers of many persons at reputed ranks. Lamo misused Timesââ¬â¢ LexisNexis account with intent to conduct some researches on various high profile subjects. In the words of Poulsen (2002), Lamo clearly found out ââ¬Ëseven misconfigured proxy serversââ¬â¢ that acted as the connecting link between public internet and Timesââ¬â¢ private intranet. As a result of his discovery; any person, who properly configuring his Web browser could have accessed into Timesââ¬â¢ private intranet. Adrian Lamo was a journalism student who was seeking a job. According to the report of Ewalt and Hulme (2004), Lamo thought that hacking high security networks would give him fame so that he could get a reputed job. Therefore, it is obvious that Lamo did not ever think of making money out of act. In most of his hacking cases, he has informed the companies regarding their flows in database. It is reported that Lamo informed The New York Times about the weaker areas of its database and it indicates that his act did not intend to deceive Times. The hacking activity of Lamo at The New York Times indicates that he was a grey hat hacker. Grey hat hackers apply their skills in order to prove their eligibilities and thereby achieve public stature (Grey Hat Hackers).
Wednesday, February 5, 2020
Gender - Homophobic violence Essay Example | Topics and Well Written Essays - 1500 words
Gender - Homophobic violence - Essay Example nder as a social construct, these social beliefs regarding what is considered acceptable levels of feminine versus masculine behaviour can often lead to homophobic violence in the gay and lesbian community. There are considerable negative viewpoints from different groups in global society stemming from religious values and established social norms which create hostilities against homosexuals if they exhibit traits outside of their expected gender roles. This paper seeks to define the concept of gender and its relationship to rising homophobic violence. The process of creating gender role stereotypes tends to begin at the infant stage, when separate colours are used for different sexes which tends to teach girls to be submissive and passive and boys more active and independent/dominant (Bangura, 2007). During childhood developmental years, children learn gender role expectations by a system of rewards and punishments where girls often attract more attention when they exhibit coy and cute behaviour (Bangura). The child learns in these years that society is an institution in which gender role expectations and masculinity versus femininity is the foundational basis on how a person is perceived by the broader social community. Gender, therefore, is absolutely the product of the social environment and how an individual functions within or the level to which he or she conforms to these social values. Femininity is often measured by criteria such as body language and posturing, vocal elements, or submissive behaviours. Masculinity is often measured by aggressiveness and a more dominant personality. There is also a religious element behind what is driving homophobic violence, with many of these beliefs being deeply enrooted into global cultures. With these measurements in mind, problems with violence against homosexuals can be explained in relation to gender role and gender identity. Some members of society believe that being attracted to members of the opposite sex is
Tuesday, January 28, 2020
Water Security Concept And Factors Environmental Sciences Essay
Water Security Concept And Factors Environmental Sciences Essay Water security simply means availability of water and secure rights to use potable water for the present and future generations. Water security has been recognised as being important enough to be enshrined in UN Human Rights Resolutions and is now a cornerstone of the UNs Millennium Development Goalsà [1]à . The concept of water security includes regional and global availability of water, environment issues, access issues and water stress. Water insecurity is all pervasive in the South Asian region, visible in conflicts and tensions erupting within and across countries. Therefore, the need to integrate water security as a key component of human security is crucial. Availability of Water. Water is widely distributed on Earth as freshwater and salt water. The bulk of the water on Earth is regarded as saline or salt water, which amounts to over 98% of the total water on Earth. The remainder of the Earths water constitutes the fresh water; this also happens to be very unevenly distributed. Nearly 70% of the fresh water is frozen in the icecaps of Antarctica and Greenland. Besides this, most of the remainder is present as soil moisture, or lies in deep underground aquifers as groundwater not accessible to human use. Only less than 0.1% of the worlds fresh water (~0.007% of all water on earth) is accessible for direct human usesà [2]à . This is the water found in lakes, rivers, reservoirs and those underground sources that are shallow enough to be tapped at an affordable cost. Water Consumption. The six billion people of Planet Earth use nearly 30% of the worlds total accessible renewal supply of water. By 2025, that value may reach 70%. Yet, at present billions of people lack basic water services and millions die each year from water-related diseases. Some believe that fresh water will be a critical limiting resource for many regions in the near future. About one-third of the worlds population lives in countries that are experiencing water stress. In Asia, where water has always been regarded as an abundant resource, per capita availability declined by 40-60% between 1955 and 1990. Projections suggest that most Asian countries will have severe water problems by the year 2025. Water Security. Water security is an elusive concept, but consensus is beginning to emerge in the world community as to its dimensions, its parameters, and the best approaches for its achievement. The Second World Water Forum Ministerial Declaration (2000), endorsed that water security implies the following:- Human access to safe and affordable water for health and well-being. Assurance of economic and political stability. Protection of human populations from the risks of water-related hazards. Equitable and cooperative sharing of water resources. Complete and fair valuation of the resource. Sustainability of ecosystems at all parts of the hydrologic cycle. Dimensions of Water Security The issue of water security has several dimensions such as competing uses, degradation of quality and scarcity. World Bank defines it as a combination of increased productivity and diminished destructivity of water. In the past, the competition for water has triggered social tensions and conflicts between water-use sectors and provinces as the domestic demands for water has forced governments to plan and invest in grand water projects such as the River-Linking Project by India and Three Gorges project by China. The water profile of the region with complex interdependencies implies that internal dynamics within a nation may now increasingly manifest itself in an inter-State dimension. Water is arguably one of humanitys most valuable resources and that is why all ancient civilizations grew along rivers be it the Indus or the Nile. It has come under increased demand due to rapid population and economic growth and may become a constant source of conflicts both within the countries as well as between countries. South Asia is an apt case study of water both as a source of cooperation and as well as conflict. The concern for water is more pressing in the South Asian mainland consisting of India, Pakistan, Bangladesh, Bhutan, Afghanistan and Nepal. The China factor and impact of its water policies has added another dimension to the problem. Water scarcity is a serious and growing problem throughout the world, and the twin pressures of Population Growth and Climate Change will only intensify this problem. The United Nations estimates that the number of people living in water-stressed countries will increase from about 700 million today to more than 3 billion by 2035à [3]à . The developing world alone will be home to 90 % of the 3 billion people expected to be added to the global population by 2025. It is estimated that by 2025, over half of the worlds inhabitants will be directly affected by water scarcity. Most of them will live in either China or India. China has access to about 7% cent of the worlds water resources, but is home to around 20% of the global population, while India possesses around 4% of water resources with only a slightly smaller populaceà [4]à . Both countries, along with eight other Asian nations and 47% of the worlds people, are heavily dependent on the Tibetan Plateau for water. Any water policies for the region therefore will have a transnational impact. Measured by conventional indicators, water stress, which occurs when the demand for water exceeds the available amount during a certain period or when poor quality restricts its use, is increasing rapidly, especially in developing countries like India and China. According to the 2006 Human Development Reportà [5]à , approximately 700 million people in 43 countries live below the water-stress threshold of 1,700 cubic meters per person. By 2025, this figure will reach 3 billion, as water stress intensifies in China, India, and South Asia. Factors Determining Water Security The scale of the ever-present societal challenge of achieving and sustaining water security is determined by many factors, of which three stand out. First there is the hydrologic environment, the absolute level of water resource availability, its inter- and intra-annual variability and its spatial distribution, which is a natural legacy that a society inherits. Second, there is the socio-economic environment, the structure of the economy and the behavior of its actors, which will reà ¬Ã¢â¬Å¡ect natural and cultural legacies and policy choices. Third, there will be changes in the future environment, with considerable and growing evidence that climate change will be a major part. These factors will play important roles in determining the institutions and the types and scales of infrastructure needed to achieve water security. The Hydrologic Environment Relatively low rainfall variability, with rain distributed throughout the year and Perennial River à ¬Ã¢â¬Å¡ows sustained by groundwater base à ¬Ã¢â¬Å¡ows, results in hydrology that is relatively easy to manage. Achieving a basic level of water security is straightforward and requires comparatively low levels of skill and investment (primarily because water is sufà ¬Ã cient, widespread and relatively reliable). Difà ¬Ã cult hydrologies are those of absolute water scarcity (i.e. deserts) and, at the other extreme, low-lying lands where there is severe à ¬Ã¢â¬Å¡ood risk. Even more difà ¬Ã cult is where rainfall is markedly seasonal or where there is high inter-annual climate variability. With increasingly difà ¬Ã cult hydrology, the level of institutional reà ¬Ã nement and infrastructure investment needed to achieve basic water security becomes signià ¬Ã cantly greater. Not coincidentally, most of the worlds poor face difà ¬Ã cult hydrologies. A legacy of trans-boundary waters, hydrologic and political or a trans-boundary hydrologic legacy can signià ¬Ã cantly complicate the task of managing and developing water to achieve water security owing to inter-jurisdictional competition both within and between nations. While this is clearly apparent in federal nations with some state sovereignty over water, it is particularly acute in the case of international trans-boundary waters. Reà ¬Ã¢â¬Å¡ecting this complexity, the UN Convention on the Law of the Non-Navigational Uses of International Watercourses was under preparation for twenty seven years prior to adoption by the UN General Assembly in 1997 and has not been entered into force. Many of todays trans-boundary basins are the result of 20th Century colonial borders that cut across watersheds and created international rivers, particularly in South Asia. The Socio-Economic Environment Water Infrastructure and Institutions. Investments in water infrastructure and institutions are almost always needed to achieve water security. Countries with difà ¬Ã cult hydrology will invariably need more infrastructure and stronger institutions, with the development of each of these being greatly complicated where waters are trans-boundary. In almost all societies, man-made assets have also been developed, from simple small-scale check dams, weirs and bunds that became the foundation of early cultures, to, at the other end of the scale, investment in bulk water management infrastructure typically developed by industrializing countries, such as multipurpose dams for river regulation and storage and inter-basin transfer schemes. Macroeconomic Structure and Resilience. The structure of economies plays an important role, with more vulnerable economies requiring more investment to achieve water security. Historical investments in water management institutions and infrastructure, the economys reliance on water resources for income generation and employment and its vulnerability to water shocks will all be relevant. Risk and the Behaviour of Economic Areas. In the poorest countries, where survival is a real concern for large parts of the population and there are few functional social safety nets, economic actors tend to be extremely risk averse, investing only after there is signià ¬Ã cant demonstration of returns. Countries with difà ¬Ã cult hydrology, such as India and Pakistan may well face the highest risks; yet have the most risk-averse populations, the lowest infrastructure investment and the weakest institutions. Climate Change Climate change is making water security harder to achieve and sustain. Global climate change is likely to increase the complexity and costs of ensuring water security. Overall, climate change is expected to lead to reduced water availability in the countries that are already water scarce and an increase in the variability with which the water is delivered. This combination of hydrological variability and extremes is at the heart of the challenge of achieving basic water security. The water security challenge will therefore be compounded by climate change and it will require signià ¬Ã cant adaptation by all countries. This will particularly be the case in poor countries which lack the institutions and infrastructure to manage, store and deliver their water resources and where climate change will be superimposed on existing and in some cases extreme vulnerabilities. According to various scientific reports, by 2050 Himalayan glaciers will have receded by 27.2%. Slow depletion of these glaciers would greatly reduce the river water flow especially to India, intensifying existing problems of water scarcity and competition. Similar changes will affect the 11 Asian countries to which Himalayan waters flowà [6]à . A 2009 Purdue University study, predicts an eastern shift in monsoon circulation caused by the changing climate, which today causes more rainfall over the Indian Ocean, Bangladesh and Burma and less rainfall over India, Nepal and Pakistan. This shift raises serious concerns for the countries expecting decreased rainfall. Summer monsoon rainfall provides 90% of India`s total water supply and as the effects of climate change become more pronounced, agrarian populations in India and Pakistan dependent on monsoons and glacial melt for irrigation will be profoundly affected. International Conventions on Water Sharing Water knows no boundaries and flows in keeping with the lay of the ground, requiring Riparian International Water Laws to govern the non navigational use. The 1815 Law for the Navigational Use of International Waters secured the vital sea lines of communication between the western countries and the colonial powers. Ironically, no such laws were created for management of the river courses. United Nations General Assembly Convention. In 1966, the International Law Association adopted the Helsinki Rules, which provide a set of guidelines for reasonable and equitable sharing of common waterways. In 1970, the United Nations General Assembly commissioned is own legal advisory body, the International Law Commission (ILC), to study Codification of the Law on Water Courses for Purposes other than Navigation. The first formal attempt to manage the riparian waters was the 1997 Draft United Nations Convention, which is yet to be ratified by the requisite number of countries. The convention has been criticized as it is practically impossible to have one convention that would incorporate all possible scenarios, as also a specific convention would be unacceptable to all members of the UN as needs and demands defer from region to region and country to country. Generalized Principles of Trans-boundary Water Allocation Water has become a significant source of conflict and has led to differing perceptions between various states such as the Arabs and Israelis, Americans and Mexicans, and among all ten Nile basin co-riparians. The generalized principles to mitigate problems of water allocation include Absolute Sovereignty, Absolute Riverine Integrity, Limited Territorial Sovereignty and Economic Criteriaà [7]à . These can be summarized as under:- Absolute sovereignty is based on hydrography and implies unilateral control over waters within a nations territory while the doctrine of absolute riverine integrity emphasizes the importance of historical usage, or chronology, and suggests that every riparian has a right to the waters that flow through its territory. Limited territorial sovereignty reflects the right to reasonable and equitable use of international waters while inflicting no significant harm on any other co-riparian while the principle of economic criteria uses the market to allocate water among competing users in an economically efficient manner. Approaches to Water Security In trying to understand the various actors and their approaches on the issue of water, it is important to recognise at the outset that there are plurality of actors in the water sector-the state which includes governments, bureaucracy and the state machinery, who can also be termed the managers and the market; civil society organisations and groups; water communities or water users; and knowledge institutions. Each group is characterised with its own strategies and approaches, and within each group there are differences and variations. Technology Solutions. As the demand for this scarce resource increases daily, it has become an urgent necessity that water should be conserved and wastage of this scarce resource should be minimized. Some of the important techniques such as rainwater harvesting, recycling, infrared or foot operated faucets, drip irrigation method etc economise the usage of water but there is a requirement to evolve technology solutions to this crisis. Drainage Basin Approach to Water Security. Drainage basins are an essential, if not the only factor in reducing water stress. They have also been historically important for determining territorial boundaries, particularly in regions where trade by water has been important. It is therefore natural to manage water resources on the basis of individual basins because the drainage basins are coherent entities in a hydrological sense.
Monday, January 20, 2020
The Rise of the Norman Empire Essay example -- Scandinavian history, Ki
ââ¬Å"Hold the wall!â⬠shouted King Harold II as the Normans began to work their way past the Anglo-Saxon shield wall. The Anglo-Saxon empire reigned over London for its fair share of time before William the Duke of Normandy decided to take it from them. William was the son of Robert I and his wife was Matilda of Flanders. William was of Viking origin and he spoke French. King Harold II was ruler of London after King Harold I died. King Harold II was the last Anglo-Saxon King of England. In the year 1066 a great battle took place that would change the way London lived forever. This battle was called The Battle of Hastings. The battle of Hastings was a very interesting battle, the outcome was not as expected. The Anglo-Saxon people had a very tough defense known as the Saxon Shield wall. This wall was nearly impenetrable because the soldiers would line up and create a wall of shields that made it impossible to break through. The Norman Soldiers also had a major field disadvantage. The area on which they fought was called Senlac Hill. Senlac Hill had a large slope and at the top were the positioned Anglo-Saxon Soldiers. The Normans were at the bottom of the hill and had enough trouble as it is getting up that hill with their heavy chain mail armor, even without the fact that King Haroldââ¬â¢s men were at the top pushing them down. At the beginning of the battle Williamââ¬â¢s forces summed up to about 7,000 and King Haroldââ¬â¢s forces numbered to about 6,000. Even though William had the playing field disadvantage he had a few things that King Harold did not. William had cavalry and a much fresher army. When the Battle of Hastings took place King Haroldââ¬â¢s men had been marching for days and were very tired, at times they marched all day long to cover... ...nd changed England forever. Many changes were brought from William the Conqueror and the Battle of Hastings can be linked to things that happen in England's history as well. Works Cited "The Battle of Hastings." History.com. A&E Television Networks, n.d. Web. 29 Apr. 2014. Barrow, Mandy. "Battle of Hastings." What Happened at the ? Woodlands Junior School, n.d. Web. 29 Apr. 2014. Trueman, Chris. "Battle of Hastings 1066." Battle of Hastings 1066. History Learning Site, n.d. Web. 30 Apr. 2014. "Battle of Hastings." History.com. A&E Television Networks, 2009. Web. 30 Apr. 2014. James. "The Bayeux Tapestry: Facts and Information." Interesting Information for Kids, Pupils, Parents and Teachers. Primary Facts, 1 Mar. 2013. Web. 01 May 2014 "Battle of Hastings." Battle of Hastings. N.p., n.d. Web. 02 May 2014. "Welcome." Battle of Hastings. N.p., n.d. Web. 07 May 2014
Sunday, January 12, 2020
Correspondence
It was a pleasure to meet you at the convention for trial attorneys In New York last week. In addition to the interesting program highlights of the regular sessions, the informal discussions with people like you are an added plus at these meetings. Your contribution to the program was very beneficial and highly Informative.You may recall that I had Just been appointed by the court to defend a woman here n Providence who has been charged with embezzling large sums of money from her previous employer. The defendant had been employed at a large department store for more than 25 years. Because of her valuable years of experience In accounting with the store, she was In charge of accounts receivable at the store. Her previous employer, the plaintiff In the case, claims that she embezzled $18,634 three years ago, $39,072 two years ago, and $27,045 last year.You mentioned that you had represented defendants In similar cases In previous years. Your assistance would be Invaluable as I prepare for this defense. If you are willing to lend your professional expertise In this case, here Is what Is needed: 1 . Within the next week, send the appropriate citations for all similar trials In which you participated. 2. Provide any other case citations that you think might be helpful In this case. 3. Meet with me In approximately two weeks for a case consultation.At hat time we can discuss compensation for your work on this matter. A copy of the formal complaint Is enclosed for your review. I will call you In about a week to arrange a time and place for our meeting. Please let me know If there Is additional Information that would be helpful In preparing for this case. Of experience will be invaluable.
Saturday, January 4, 2020
Sample of Leadership Essay
Sample of Leadership Essay The Meaning of Leadership Leadership is an ability to lead people in order to achieve specific goals. This is a managerial relationship between the leader and his or her followers based on an effective combination of different sources of power for the specific situation. As a rule leadership is aimed at encouraging people to achieve common goals. The necessary requirement of leadership is the possession of power in certain formal or informal organizations of different levels and scale. These organizations may range from the state and groups of countries to government agencies, local governments, national or social movements and groups. Formalized leaderââ¬â¢s power is traditionally fixed by law. But in all cases the leader possesses social, psychological and emotional support in the community or in groups of people who follow him or her. There is formal and informal leadership. In the first case the subordinates are influenced from the certain position. The process of influencing people through personal abilities, skills and other resources is called informal leadership. It is believed that the ideal leadership combines two bases of power: personal and organizational. Leadership aims at achieving organizational effectiveness. On the one hand, leadership is considered to be a particular set of qualities attributed to those who successfully influence the others. On the other hand, this is a process of no-force achieving goals by certain groups or organizations. Since ancient times the concept of effective leadership was traditionally defined on the basis leaderââ¬â¢s qualities or samples of his or her behavior. Anyway, leadership is a
Subscribe to:
Posts (Atom)